Indonesia Conference Directory

Corresponding Author
Reza Bachtiar

Institutions
Economics and Business Faculty, Telkom University.

Abstract
Telkomsel as one of the largest telecommunications operators in Indonesia. In 2012 Telkomsel is having organization transformation to keep growing and be sustain in digital era. Beside the business model that changed, the company culture is changed that called The Telkomsel Way. In 2016 Telkomsel have implemented digital culture to improve performance and become digital mastery in digital era. Telkomsel has defined the value of digital culture are agility, anticipatory, creativity, innovation, experimental, open mindset, and networking. But from the internal data that found phenomena the organization culture entropy is increasing 3 percent while the company performance growth is slowing down 2 percent in 2017. The purpose of this research is to find out and conduct in-depth analysis and studies to review how much the effect of company transformation and digital culture in Telkomsel Area 2 Jabotabek Jabar on employee performance. Data collection method has been done by using questionnaire to all of employee of Telkomsel of Area 2 Jabotabek Jabar that the population is 855 employees and the sample is 288 employees. Data have been tested and analyzed using path analysis. The results show both company transformation and digital culture company affects employee performance both directly and indirectly.

Keywords
Company Transformation, Digital Culture, Employee Performance, Path Analysis

Topic
Digital Talent Management

Link: https://ifory.id/abstract/4L93b6DNnCUT

Corresponding Author
Lela Lestari

Institutions
a) Master of Management, Faculty of Economics and Business, Diponegoro University
Jl. Erlangga Tengah 17, Semarang 50241, Indonesia
*lelalestari17[at]gmail.com

Abstract
This qualitative phenomenological study aims to test and compare the perceptions of workers in the banking sector regarding the implementation of STARA in their work. This study was conducted through in-depth interviews with informants regarding perceptions about optimizing the implementation of STARA in the banking sector in the form of banking digitalization in Industrial Revolution 4.0 era. The position of informants is a teller, customer service, and back office. This study used a non-random sampling method with a purposive sampling technique which amounts to 12 informants. The results of the study show that the majority of bank employees in the position of frontline (teller and customer service) feel threatened that their position can be replaced by the implementation of STARA. However, some of the informants at the frontline position also stated that they did not feel threatened because they believed that customers more feel comfort when served by humans rather than being served by machines. Meanwhile, bank employees in the back office position have not yet felt a threat with the implementation of STARA because they feel that the analysis process cannot be fully carried out properly by a system and still requires humans. In addition, several employees stated that the implementation of STARA made it easier to complete their work and could be used as an opportunity to achieve work performance. The results of this study also show that overall employees have not felt a decrease in work commitment to the organization, obstacles in career advancement, the desire to move, be cynical, and feel depressed when working with the predicted that STARA implementation can take their jobs.

Keywords
STARA; banking digitalization; disruptive technology; bank employees; work commitment

Topic
Management

Link: https://ifory.id/abstract/Axz8Uyca9KbP

Corresponding Author
Dani Satria Nuraman

Institutions
Parahyangan Catholic University

Abstract
Income inequality is one of the problems faced by developing countries including Indonesia. An effort that is believed to be able to overcome this problem is financial inclusion. Financial inclusion is all efforts aimed to eliminate all forms of price and non-price barriers towards people access to utilize financial services. Higher financial inclusion is expected to encourage an easier access to financial services for the communities, especially for the low income people who have limited access to financial services. This study use the panel least square method with secondary data of 33 provinces in Indonesia from 2015 to 2017. The Gini ratio is used as a proxy for the income inequality, while financial inclusion is illustrated by the ratio of outstanding loans of small and medium enterprises to the total outstanding loan at commercial banks. This study aims to see the impact of financial inclusion on income inequality in 33 provinces in Indonesia. The results of this study indicate that inclusion affects negatively and significantly on the gini ratio, which means that the increase in financial inclusion can reduce the income inequality.

Keywords
Income Inequality, Financial Inclusion, Indonesia

Topic
Economics

Link: https://ifory.id/abstract/vtGehdcMzjW9

Corresponding Author
Chusnul Chotimah

Institutions
Airlangga University

Abstract
The financial structure reflects how the companys assets are spent, thus the financial structure is reflected in the overall liability of the company. For companies that go public such as the Whole Sale And Retail Trade industry, the financial structure is important because the proportion of each source of funds will determine the companys cost of capital. The high value of Cost of Capital companies makes the company more at risk compared to companies with lower capital costs. Companies with high risk are less favored by investors in the capital market. Moreover, for retail companies, where most of their assets are in the form of receivables and inventory, the value depends on the permanence of the level of profitability of each company, so it is not so dependent on long-term debt financing and is more dependent on short-term financing, therefore to make optimal financial structure, management needs to know what factors influence it. The study aims to determine how the influence of asset structure, company size, ROI, operating leverage, sales growth and tax burden on the financial structure of the Whole Sale and Retail Trade industries that go public on the IDX. Firm size, ROI and sales growth have a significant effect on financial structure while asset structure, operating leverage and tax burden have no significant effect on the financial structure.

Keywords
Financial structure, asset structure, company size, Return On Investment, operating leverage, sales growth, tax burden, retail.

Topic
Enviromental Accounting

Link: https://ifory.id/abstract/82HknFAewBzc

Corresponding Author
Jin Su Jeong

Institutions
a) Departamento de Didáctica de las Ciencias Experimentales y las Matemáticas, Universidad de Extremadura, Avd. de la Universidad s/n, 10004 Cáceres, Spain *jin[at]unex.es

Abstract
The teaching of science has traditionally focused on cognitive factors. However, it shows many glitches of teaching, which is necessary to adapt new instruction methodology to examine affective factors for the science education. This research presents to examine the affective dimension of students based on influence of their curricula background and teaching methodology while learning science in an undergraduate program. During 2015/16 course, the study was performed in a general science course at the Teaching Training School of the University of Extremadura (Spain). A total of 126 students contributed for the study proposed and the classroom was divided into a traditional and flipped group. In the traditional group, a traditional-teaching methodology was performed. For the flipped group, a “flipped classroom” setting was followed. In both groups, students enrolled to the course suggested from dissimilar curricula background, that is, science, social sciences, arts and technology background. According to the results, the students- curricula background and teaching methodology have a significant influence in their affective dimension. Students participated in the flipped group exposed less negative and more positive emotions in the learning process. These affective dimensions were more noteworthy in the not-scientific background students as their curricula background. These results are particularly relevant because the not-scientific background students are usually facing more difficulties in learning science as the bigger group in the course proposed.

Keywords
Flipped classroom; Science teaching/learning; Affective dimension; instruction methodology

Topic
SCIENCE EDUCATION

Link: https://ifory.id/abstract/2TydMzgbUKA4

Corresponding Author
Jin Su Jeong

Institutions
a) Departamento de Didáctica de las Ciencias Experimentales y las Matemáticas, Universidad de Extremadura, Avd. de la Universidad s/n, 10004 Cáceres, Spain *jin[at]unex.es

Abstract
There are many educational applications nowadays, which permit students to strengthen theoretical and/or numerical concepts as an interactive approach. This research presents an educational application to support acid-base titration “self-learning” in flipped science education. This educational application is based on an ad-hoc open MATLAB code, which aims to create acid-base titration curves as self-learning in an interactive and collaborative layout. With this flipped educational application, students can practice and repeat comprehensive titration alternatives, i.e. strong, weak or polyfunctional titration acids and bases. Also, for each titration, each compound in different concentration can be chosen as the titration for the science education. The results show the proposed educational application as “self-learning” plans the titration curve, the former curve derivative and the numerical results. Particularly, students can have the opportunity to compute and analyze the titration-s final point graphically and numerically. Therefore, this flipped educational application is a possible and practical method to develop the fundamental concepts of acid-base titration via the numerical exercise practice supported by computer-based design.

Keywords
Self-learning tool; Science education; Flipped classroom; Inquiry-based; Computer-based learning; Discovery learning

Topic
SCIENCE EDUCATION

Link: https://ifory.id/abstract/VRTpeD48LdMt

Corresponding Author
Dedi Mulyadi

Institutions
Puslit Geoteknologi LIPI

Abstract
Dolomite minerals are currently widely used for a variety of uses, including fertilizers, glass mixtures, as materials for making cement, necessary elements for making ceramics, etc. Research on the composition of dolomite in rock gaming of the Wonosari Formation, Gunung Kidul Regency, Central Java. The method used in this study is petrography and AAS. The results of the petrographic analysis showed that the presence of small amounts of dolomite while the AAS analysis also showed the presence of not too little (little) dolomite. Conclusion Dolomite contained in the Wonosari formation is not too dominant; at present, the exploitation for dolomite minerals continues to be carried out with open mining methods. Conclusions from this study Dolomite wonosari Formation is not well used both for fertilizer and cement materials because the composition is only 3%

Keywords
Composition of dolomite, Wonosari Formation. dolomit percentage

Topic
Physics

Link: https://ifory.id/abstract/hyYUr2AwNqcG

Corresponding Author
Nugroho Syarif Setiawan

Institutions
[1] Institut Teknologi Sepuluh Nopember
[2] Pusat Sumber Daya Mineral, Batubara dan panas Bumi

Abstract
Noise that recorded at magnetoelluric data acquisition make the recorded data quality not good enough so the information that obtained after data processing might be not correct or not suit with the subsurface condition. Several characters that we can see at the noisy magnetotelluric data are the spiky shaped and non-stationarity time-series curve. This non-stationarity character can-t be handled by Fourier Transformation process. In this research used Empirical Mode Decomposition (EMD) method in original of Huang as filtering method in order to overcome the non-stationarity. This method decomposed the signal into group of oscillation mode called Intrinsic Mode Decomposition (IMF). One of the best IMF chosen as the filtering result by spectrum analysis in frequency domain. From the filtering result obtained that the time-series curve getting smoother and the non-stationarity character compressed. From this research concluded that EMD filtering can be implemented at magnetotelluric data processing and can emphasized the effect caused by noise.

Keywords
Empirical Mode Decomposition (EMD), Intrinsic Mode Function (IMF), Magnetotelluric

Topic
Electromagnetic Methods

Link: https://ifory.id/abstract/HRYm2xhT6MnB

Corresponding Author
Jaya Mahar Maligan

Institutions
Department Agricultural Product Technology, Agricultural Technology Faculty, Brawijaya University

Abstract
Soybean is a agricultural commodity, being third in harvest amount after paddy and corn. The processing of soybean using heat causes the bioactive compounds to decrease. There is another way to increase the bioactive compounds in soybeans. Elicitation is a method that functions to increase biosynthesis of secondary metabolite formation in plants by using elicitor. This research used factorial Randomized Block Design method with 2 factors which were temperature (25oC, 35oC and 45oC) and pulsed field (3 kV, 5 kV and 7 kV). Electrical voltage test result from device obtained input voltage 0,76 V resulted 3 kV, 1,04 V resulted 5 kV, 1,4 V resulted 7 kV. Research results on soybean extract obtained total phenol as much as 2,76 mg GAE/g, total flavonoid 0,31 mg QE/g, tannin content 0,18 mg/g, IC50 as much as 626,95 ppm. Whereas for the results of extraction of soybeans in the best treatment was obtained at the pulsed field of 3 kV and temperature of 25oC. Total phenol result was 2,92 mg GAE/g, total flavonoid 0,37 mg QE/g, tannin content 0,19 mg/g, antioxidant activitiy IC50 128,84 mg/L

Keywords
Soy Bean, Elicitation, Pulse Electric Field, Temperature

Topic
AGRICULTURAL PRODUCT TECHNOLOGY

Link: https://ifory.id/abstract/dYT4jvrPN7uE

Corresponding Author
Arif Faisol

Institutions
Papua University, Jember Universuty

Abstract
Drougth is one of main natural disaster in Indonesia. Some regions in Indonesia are very vulnerable to drought including Java. These research aimed to mapping droughtness level on agriculture area in East Java using MODIS Global Terrestrial Evapotranspiration and Thornthwaite Mather methods. A total of 20 MODIS Global Terrestrial Evapotranspiration image recording 2018 – 2019 and ground cek on agriculture area at some location were used for analysis. Research show that MODIS Global Terrestrial Evapotranspiration and Thornthwaite Mather methods quite accurate in describing the level of drought on agriculture area.

Keywords
MODIS Global Terrestrial Evapotranspiration, Drought, Agriculture, Thornthwaite Mather.

Topic
AGRICULTURAL ENGINEERING

Link: https://ifory.id/abstract/eYxpafNMuBgR

Corresponding Author
Kiki Fibrianto

Institutions
Brawijaya Senso-Gastronomy Center, Faculty of Agricultural Technology, Universitas Brawijaya

Abstract
Conservatively, tea is an aromatic beverage made from dried leaves of tea plant (Camellia sinensis). However, lemongrass (Cymbopogon citratus) and pandan leaves (Pandanus amarylifolius Roxb.) can also be processed as herbal tea to develop their functional properties. This current study aims to investigate the sensory profiles of the herbal tea as well as to determine the optimum techniques for hot, iced and hot+iced brewings. Spectrum Descriptive Analysis method was conducted by involving 12 trained panelists to develop sensory vocabularies. Meanwhile, the sensory optimization was conducted by Just about Right (JAR) method involving 106 consumer respondents. The Spectrum data shows that 4 out of 12 sensory attributes, including sweet, astringency, lemongrass flavor, and pandan flavor; were significantly affected by different brewing techniques (p-values <0.05). Through Penalty analysis on JAR data, it shows that sweet and pandan flavor were optimum for hot brewing. Meanwhile, the sweet and astringency were optimum for cold brewing. Under current set up, there is no optimum attributes was obtained for hot+ice brew technique. Considering their functional properties, the cold brewed herbal tea shows the most superior among the samples tested as it shows the highest total sugar content, total phenolic compound, and antioxidant activity (p-values<0.05).

Keywords
Brewing technique, Lemongrass, Pandan, Sensory optimisation

Topic
AGRICULTURAL PRODUCT TECHNOLOGY

Link: https://ifory.id/abstract/RmPrZfHe2Bu9

Corresponding Author
Musthofa Lutfi

Institutions
(a)Departement of Agricultural Engineering, Faculty of Agricultural Technology, Brawijaya University
*lutfi[at]ub.ac.id
(b)Department of Indonesian Language and Literature Education, Faculty of Literature, State University of Malang
(c)Department of Psychology, Faculty of Social and Political Sciences, Brawijaya University
(d)Department of Administration of Bussiness, Faculty of Administration Science, Brawijaya University

Abstract
In East Java, there are clove leaves oil refining as a rural people business due to it have been both ease of processing operation and low capital needed. This clove leaves oil production process uses the old leaves that fall naturally when dry season period means it is more conserve and environment friendly. East Java rural distillers have been using only single boiler for steam, water and raw materials so that the investment costs are cheaper. This study aims to find out the use of appropriate technology in clove leaves distillation process to increase clove oil both yield and quality. Two kinds of efforts conducting i.e. introduce leaves crusher as raw material and replace old chamber material with stainless steel. After clove leaves crushed, there are three grades of raw materials i.e. rough leaves, smooth leaves, and non-crushed leaves. Then, they are distilled in the new stainless steel boiler to compare the oil yield and quality. The result of crushed leaves treatment show that there are different volume condensate resulted from the same volume of raw materials i.e. 128.2 liter and 117.2 liter from smooth grade crushed leaves and rough grade respectively. The highest percentage of clove oil (15.07%) get from rough grade crushed leaves. Replacing chamber material with stainless steel affects to brightness of the clove oil. In conclusion, these two kinds of efforts to improve appropriate technology for clove oil production can increase both yield and oil brightness. Furthermore it can improve the competitive advantages of the product.

Keywords
Clove oil, crushing leaves, traditional distillation, Small enterprises

Topic
AGRICULTURAL PRODUCT TECHNOLOGY

Link: https://ifory.id/abstract/4yKZdjM6zWBr

Corresponding Author
Endah Rahayu Lestari

Institutions
Department of Agroindustrial Technology, Faculty of Agricultural Technology,Universitas Brawijaya

Abstract
In a turbulent business environment, innovation is the most important issue for business success. This paper addresses two main problems. First, we examine the relationship between market orientation and entrepreneurial orientation as key drivers of innovation. Second, it evaluates the impact of innovation on business performance. Market orientation only focuses on two dimensions, namely the dimensions of customers and competitors. Entrepreneurial oriented is defined along dimensions: proactive, aggressive, autonomy, innovative, and risk taking. Innovation is measured in two dimensions, i.e. product innovation and process innovation. While business performance was represented by financial indicators. Data was collected from small food industries in Indonesia and analyzed by structural equation models. This finding provides support for the positive influence of both market orientation and entrepreneurial orientation on innovation. Finally, innovation becomes a positive contributor to business performance. The study has implications that SMEs with market orientation and entrepreneurial orientation should place much emphasis in order to enhance innovativeness and ultimately achieve better performance

Keywords
business performance, entrepreneurial orientation, innovation, market orientation

Topic
AGROINDUSTRIAL PRODUCTION SYSTEM MANAGEMENT AND REGULATION

Link: https://ifory.id/abstract/XxKRJp8j7ZWu

Corresponding Author
Nur Latifatul Qodriyah

Institutions
Department of Agricultural Product Technology, Faculty of Agricultural Technology, Universitas Brawijaya Jl. Veteran, Malang 65145 E-mail : agustinwardani[at]ub.ac.id

Abstract
Foodborne disease, also referred to as foodborne illness are caused by bacteria, viruses, parasites or chemical substances entering the body through contaminated food or water. Foodborne diseases may lead to long-lasting disability and death. Bacteria are agents which cause 60 % foodborne illness with cases that require hospital treatment. Antimicrobials, such as antibiotics, are essential to treat infections caused by bacteria. However, their overuse and misuse in human medicine has been linked to the emergence and spread of resistant bacteria, rendering the treatment of infectious diseases ineffective in humans. The use of antibiotics as an antimicrobial has undergone many obstacles along with increased number of pathogenic bacteria resistance case. Antimicrobial resistance is one of the main threats to modern medicine. Bacteriophage could be an effective and safe method to decrease the presence of pathogens in food. In this study, lytic phages were isolated and examined for their efficacy to control pathogens. It was isolated using the "plaque assay" method and the lytic ability of isolated phage was confirmed using turbidity test. The isolated φKA5 from chicken skin samples was able to inhibit the growth of bacterial host (Cronobacter spp.) specifically Cronobacter malonaticus strain 05CHPL53. Infection of Cronobacter malonaticus using φKA5 for 360 minutes showed the significant reduction of Cronobacter growth. Based on morphological classification with the ICTV system, the φKA5 can be classified into the Myoviridae family with a contractile tail. These data suggested that the phages isolated from raw chicken skin are potential agents for controlling Cronobacter spp.

Keywords
Bacteriophage, Biocontrol, Cronobacter spp., Foodborne illness, Isolation

Topic
FOOD SAFETY AND SECURITY

Link: https://ifory.id/abstract/qMhUAnPFeJY8

Corresponding Author
Kiki Fibrianto

Institutions
Brawijaya Senso-Gastronomy Center, Faculty of Agricultural Technology, Universitas Brawijaya

Abstract
Mind and body relaxation can be stimulated by consuming tea and enjoying music. While green tea contains L-theanin which stimulate relaxation, music in general may change moods and emotions. This current study aims to determine the effect of listening to Mozart-s symphony number 6.K.43 at fundamental tone F music on emotion and sensory perception when consuming green tea. Three brewing durations (1, 3 and 5 minutes), 3 levels of listening time to the music (1, 3, and 5 minutes) with 4 different treatment techniques. There were 14 trained panellists involved in the study and they were asked to assess 15 sensory attributes including taste, flavour and mouth-feel of Wonosari green tea on Spectrum method. In general it can be concluded that the music mostly enhance the intensity of sensory attributes (p-value<0.05). It is also important to note that positive emotions improved when respondents listening to Mozart-s regardless the duration of listening.

Keywords
green tea; emotion; sensory, music

Topic
AGRICULTURAL PRODUCT TECHNOLOGY

Link: https://ifory.id/abstract/dVThkJM7fj8n

Corresponding Author
Kiki Fibrianto

Institutions
Brawijaya Senso-Gastronomy Center, Faculty of Agricultural Technology, Universitas Brawijaya, Malang, Indonesia

Abstract
Jam is one of complementary foods which has the viscous texture and usually prepared from fruit puree. The fruit contains pectin in which it will be combined with sucrose and acid to form gel. Banana peel also contains the pectin. This current study aims to investigate the effect of citric acid and sucrose concentration on physico-chemical and sensory characteristics of Candi banana peels jam. Completely Randomized Block Design was assigned to investigate the main factors. Factor I is the citric acid concentration (0.2% and 0.4% w/v). Factor II is the concentration of sucrose (50%, 60%, and 70% w/v). Each treatment was replicated 3 times. “Candi” banana peels jam with combination 0.2% of citric acid and 70% of sucrose is considered as the best treatment. The best Candi banana peels jam has been characterised by 48.80% water content; 4.97 pH values; 45.10 0Brix total dissolved solids; and the length of spread is 9.3 cm. While the sensory attributes intensity were 8.8 for sweetness; 2.4 for sourness ; 3.4 for astringency; 8.9 for color; 5.5 for firmness; 10.5 for spreadibility; and 8.4 for the length of spread.

Keywords
banana peels, jam

Topic
AGRICULTURAL PRODUCT TECHNOLOGY

Link: https://ifory.id/abstract/UNQKTrM62zuw

Corresponding Author
Rambu Abigail Deanira Kapita

Institutions
Department of Agroindustrial Technology, Faculty of Agricultural Technology, Brawijaya University
Jl. Veteran, Malang 65145, Indonesia

Abstract
Biodegradable plastic is starch-based plastic that can be naturally decomposed by microorganisms. Cassava is one of the primary starch-producing plants. The increasing amount of cassava production increases cassava peel waste. Cassava peel has 50% of the starch content in the tuber. The factors that are affecting the production of biodegradable plastics are temperature and drying duration. This study aims to obtain the optimum temperature and drying time for the production of biodegradable plastics from starch and flour of cassava peel waste that has optimal mechanical properties and swelling. Response Surface Methodology (RSM) with a Central Composite Design (CCD) method was employed. The experimental design included two factors and three responses. The first factor was the drying temperature (40 °C, 50 °C, and 60 °C) and the second factor was the drying duration (5 hours, 6 hours, and 7 hours). The responses measured were tensile strength, elongation, and swelling. It was found that the optimum condition of the process was at the drying temperature of 57.79 °C and drying duration of 5 hours. Based on the process above, the tensile strength of the biodegradable plastic was 2554.65 N/m2; elongation of 16.67%; and swelling of 124.17%. Biodegradation testing for 12 days resulted in a mass reduction of 58.30%.

Keywords
Biodegradable plastic; Cassava starch, Cassava peel waste; Optimisation

Topic
AGRICULTURAL PRODUCT TECHNOLOGY

Link: https://ifory.id/abstract/Hk3xadFyQMRG

Corresponding Author
Tunjung Mahatmanto

Institutions
a) Jurusan Teknologi Hasil Pertanian, Fakultas Teknologi Pertanian, Universitas Brawijaya
Jl. Veteran, Malang 65145, Jawa Timur, Indonesia
*tjmahatmanto[at]ub.ac.id

Abstract
About one-third of the food produced globally is lost or wasted, with production-to-retailing accounting for the major stages in which food is lost. Among food commodity, fresh produce have the highest rate and percentage of losses due to deterioration, especially in countries with warm and humid climate. Although climate-controlled chain facitilites and transportation can address this problem, they require huge investments. A potential approach to delay deterioration affordably is to apply protective barriers directly to the produce. Here, we report the development of an active coating from low cost materials for on- and off-farm applications. First, we determined the suitable composition of corn starch and glycerol to form the coating gel. We then supplemented live Lactobacillus plantarum–a lactic acid bacterium commonly found in fermented food products–as the active ingredient to the formulation and applied it to coat fresh-cut apples as a model system. Physical analysis show that the application of the active coating delayed browning, reduced weight loss, and improved the texture stability of the fresh-cut apples whereas chemical and microbiological analyses show a slight reduction of the pH and cell viability during storage. Anti-bacterial assay of the of active coating show effective inhibition against Escherichia coli–a model food spoilage bacterium. Although these results suggest that active coating may delay produce deterioration, field trials will be needed to evaluate its efficacy in preventing losses along the supply chain–a critical component to ensuring food security.

Keywords
Lactic acid bacteria; active coating; fresh produce protection; corn starch

Topic
FOOD SAFETY AND SECURITY

Link: https://ifory.id/abstract/GDrxf2ELatjZ

Corresponding Author
Ihsan Wira Senjaya

Institutions
a) Master Program of Environmental Science, School of Postgraduate Studies, Diponegoro University, Semarang - Indonesia
Jalan Imam Bardjo SH No. 5, Semarang, Indonesia
*matematison[at]gmail.com
b) Faculty of Science and Mathematics, Diponegoro University, Semarang - Indonesia
Jalan Prof. H. Soedarto S.H, Tembalang, Semarang 50275, Indonesia

Abstract
Magelang Regency is one of the national rice providers. As a National rice provider, the availability of rice need to be maintained sustainably in order to meet the needs of Magelang Regency and Surrounding area. As the main source of rice production, paddy fields must be protected from the conversion of built-up land such as settlements, tourism sites and others. local governments need to design policies that ensure the availability of surplus rice. This study aims to measure the impact of production policy scenarios and the application of law in Magelang Regency to protect the availability of surplus rice using system dynamic approaches. The scenarios that developed were law enforcement to decrease conversion of paddy fields and increased crop indexes to increase rice production, so increased the availability of rice as well. Simulation data were compared with the real data of the last five years from 2013-2017 (Central Bureau of Statistics of Magelang Regency) and had values that did not differ greatly from the actual data with errors of less than 10%. The simulation results showed that the first scenario could meet the needs of 216.6% rice with a surplus of 133,509.52 tons and the second scenario met 229.5% of the rice needs with a surplus of 148,257.43 tons.

Keywords
System Dynamic; Paddy Field; Rice; Scenario

Topic
FOOD SAFETY AND SECURITY

Link: https://ifory.id/abstract/yCpke8cEMfL7

Corresponding Author
Bambang Purwantana

Institutions
Department of Agricultural and Biosystems Engineering, Universitas Gadjah Mada, Jl. Flora, Bulaksumur, Yogyakarta 55281, Indonesia

Abstract
Operational Performance of Agricultural Machineries Managed by Custom Hiring (UPJA) in Banyumas District of Central Java Province Bambang Purwantana1, Murtiningrum1, Sri Markumningsih1, Muhammad Makky2, Aswaldi Anwar2 1Department of Agricultural and Biosystems Engineering, Universitas Gadjah Mada, Jl. Flora, Bulaksumur, Yogyakarta 55281, Indonesia 2Faculty of Agricultural Technology, Universitas Andalas, Kampus Unand Limau Manih, Padang 25163, Indonesia E-mail: bambang_pw@ugm.ac.id ; tiningm@ugm.ac.id; sri_markumningsih@ugm.ac.id Abstract. Agricultural mechanization, especially in term of utilization of agricultural machinery, has important role in increasing capacity, efficiency, and effectiveness of agricultural production process. Therefore, in order to mechanize Indonesian agricultural system, Ministry of Agriculture has facilitated farmers with many agricultural machineries. Farmer institutions that were formed and designated to utilize and manage those agricultural machineries is Agricultural Machinery Custom Hiring (UPJA, Usaha Pelayanan Jasa Alat mesin pertanian). In this research, the operational performance of agricultural machineries managed by the custom hiring (UPJA) in Banyumas District of Central Java Province were studied. The research was done by desk study, focus group discussion, field survey to 7 of 49 UPJA, and measuring the operational performance of machineries utilized by those UPJA. The results showed there was still no professional UPJA available in Banyumas. All of UPJA were in beginner status. The common owned and operated agricultural machinery was hand tractor, while four wheel tractor, rice transplanter, power weeder, and rice combine harvester were limited. In general the operational performance of the machines were low. The most factor affected the performance were time required for transportation from garage to the field. In case of hand tractor, the time consumed for transportation was 8-14% of total working hour per day (8 hours). For four wheel tractor, rice transplanter, and rice combine harvester, the time required for transportation were 4-9%, 8-16%, and 9-18% of total working hour respectively. The other factors slightly affected the operational performance were time losses due to machine preparation or setting and machine trouble. It is suggested to facilitate towing truck to transport the machines, or develop garage not far from field area. Empowering UPJA in management and technical skills are also needed. Keywords: Performance; operational; machinery; custom hiring

Keywords
Performance; operational; machinery; custom hiring

Topic
Energy and agricultural machinery

Link: https://ifory.id/abstract/vD9JbaRk7qyM

Corresponding Author
andreas wahyu krisdiarto

Institutions
(a)Instiper Agricultural Univesity,
Jl. Nangka II, Maguwoharjo, Depok, Sleman, Yogyakarta-55281, Indonesia
* andre0402[at]yahoo.com
(b)Atma Jaya Yogyakarta University,
Jl. Babarsari No.44, Janti, Caturtunggal, Kec. Depok, Kabupaten Sleman, Daerah Istimewa Yogyakarta 55281, Indonesia

Abstract
After harvested, the oil palm fresh fruit bunch (FFB) has to evacuated from the field and transported to the oil palm mill. In most cases, it transported using the trucks. FFB transportation should be optimized in order to achieve the best FFB quality and minimum cost. This research was aimed to develop tools to monitor trucks as FFB transport equipment, due to there are some deviations in the field. The Development of the application using the method: business process analysis, system analysis, system design, and implementation and functional test. The application software run as an Android-based application, as a map-based application, and using location-based service. The system also runs as a web-based application and has been tested on FFB logistic system in private plantation company. It monitored the truck route and FFB loading and transporting activities in the field, as well as gave instruction to the truck driver in order to avoid the heavy queue in an oil palm mill.

Keywords
oil palm; FFB; transportation; mobile-based application

Topic
Other Agricultural and biosystems topic

Link: https://ifory.id/abstract/EZMVW2XHgB46

Corresponding Author
Iqbal Iqbal

Institutions
Hasanuddin University

Abstract
Abstract, Sugarcane plantation of Takalar have big potential organic waste alike sugarcane litter. Sugarcane litter is organic waste that could be processed into organic fertilizer in form of compost. The objectives of this study were to determine the potential of sugarcane litter and to determine the machinery requirement for sugarcane litter management in PG Takalar. The result showed that the average availability potential of sugarcane litter in PG Takalar was 19.96% or 20% from each stem of sugarcane. In total, with 4 186 ha area of PG Takalar, the potential of sugarcane litter was 32 860 ton/year. Nowadays, in PG Takalar, the management of sugarcane litter is done conventionally by burning the litter in the field. It is also found from the study that to manage the sugarcane litter in 4 186 ha area, the number of machinery needed to support the mechanization of sugarcane litter management were 48 units of tractor, 13 units of trash rake, 31 units of trailer, 4 units of applicator, 18 units of chopper, 3 units of truck, 3 units of composting turner, and 3 units of loader.

Keywords
potential, management, mechanization, sugarcane litter, sugarcane

Topic
Energy and agricultural machinery

Link: https://ifory.id/abstract/ATM7dG2Y3nxz

Corresponding Author
Rizky Brisha Nuary

Institutions
a) Department of Agro-industrial Technology, Faculty of Agriculture Technology, Universitas Gadjah Mada, Indonesia
*rizky.brisha.n[at]mail.ugm.ac.id

Abstract
Salak Pondoh Sleman (Salacca edulis cv Reinw) is a product that has been certified as a geographical indication product. Therefore, maintaining its sustainability is importantly required. This study aims to determine the sustainability status of Salak Pondoh Sleman farming system based on its sustainability index, especially in a socio-economic perspective. To achieve the goal, the socio-economic factor that influences the sustainability status of Salak Pondoh Sleman farming system was determined. Economic sustainability was assessed based on income, selling price, and farming costs, while social sustainability was reviewed based on the participation of farmers in their group. A structured questionnaire was developed and distributed through a survey in three subdistricts area within Sleman District, namely Tempel, Turi, and Pakem in 2019. A multi-dimensional scaling for Rapid Assessment Techniques for Salacca (RapSalacca) test, a test developed for determining sustainability index based on an influential factor, was performed and revealed that selected attributes contribute to sustainable farming of Salak Pondoh Sleman. The sustainability of Salak Pondoh Sleman farming system is further explained in this study.

Keywords
Salak Pondoh Sleman, Socio-economic sustainability, RapSalacca

Topic
Other Agricultural and biosystems topic

Link: https://ifory.id/abstract/Y4Xgfw6kWjQF

Corresponding Author
Faralaily Erika Putri

Institutions
Airlangga University

Abstract
Spin off is a change in the business activities of conventional banks into Islamic banks. The three spin off approaches are pure method, acquisition, and conversion. The success of spin off can be measured through the performance of Islamic banks (fixed assets, deposits, BOPO, NPF, FDR, ROA, and CAR). This study aims to see whether there are differences from the three methods of separation before and after spin off, and see which spin off method is considered the best seen from the performance of Islamic banks. In this study the authors used a quantitative method with Wilcoxon Test and One Way MANOVA Test, which later will be processed using SPSS 22 software. The data collection technique used was purposive sampling, where the sample consisted of six Islamic banks that did spin off. Data processing consists of literature studies, data collection, and results analysis. The results of this study state that not all variables have differences between before and after spin off. Furthermore, from the three spin-off methods there are two methods that have advantages in the performance of Islamic banks. The acquisition method is better if seen from the BOPO and CAR variables, while the conversion method is better in FDR and ROA variables.

Keywords
Spin off, Islamic bank, Performance of Islamic banks

Topic
Islamic Finance and Banking

Link: https://ifory.id/abstract/RjMT6NbvC8ry

Corresponding Author
Y Aris Purwanto

Institutions
1Department of Mechanical and Biosystem, IPB University
2Center for Tropical Horticulture Study, IPB University

Abstract
Ultrafine Bubble technology is a new and emerging science, capable of infusing ultrafine bubbles in liquids for longer periods of time. Ultrafine bubble are extremely small gas bubbles in liquid. This paper discussed the application of ultrafine bubbles water for seed germination. Seed germination is the process from seed to a sprout in which the metabolic process of a plant gets activated after a period of dormancy. A high seed germination percentage is important for vegetable production. During germination process, the seeds rapidly recover physically from maturation drying, resume a sustained intensity of metabolism, complete essential cellular events to allow the embryo to emerge and prepare for subsequent seeding growth. Comparison experiments of seed germination rate were performed using distilled water and water containing ultrafine bubbles. This experiment utilized the dissolved oxygen concentrations of distilled water with approximately 8-9 and 20-24 mg/L. Rice, soybean, papaya and garlic seed was used as seed samples. The result indicates that the application of ultrafine bubbles water had an effect on seed germination rate.

Keywords
Ultrafine bubble, seed germination, sprout, dissolved oxygen

Topic
Biophysics engineering

Link: https://ifory.id/abstract/4tuNZFLhA3va

Corresponding Author
Gilang Ramadhan

Institutions
Universitas Sultan Ageng Tirtayasa

Abstract
This research is about how menak reclaim right of landowner from Pemda Sumedang. This case was begin at 1996 when BPN Sumedang set up Land Consolidation (LC) project that must be land acquisition at kelurahan Situ, North Sumedang. In the middle of project there are many mistake in land measurement that resulting in losses of landowners. Not yet over, the project was abandoned until 2010 when local government launching Induk Pusat Pemerintahan Kabupaten Sumedang (IPP) in the same location. Even though the landowner for decades never received a compensation, even utilize their land for farming, business, and build a material when LC and IPP occupy their rights. Obscurity fate of menak that causes them to against Pemda Sumedang for gaining compensation. Therefore this research specifically aims to identify the factors which nurture the resistance movement from among menak, and how it can operated and developed to reach their goals to get compensation. This research is a qualitative research, designed as a descriptive method. I-ts finding that all the loss that held by menak cant move them onto mass movement, caused of many of elder among them, and the fact that menak had no confrontation culture since feodalism era in Indonesia so that menak delegate their affairs to the youngest ancestry Mr Syawaludin to prosecute they matters to Pemda Sumedang in behalf of menak. This movement has messianism characteristic because just rely on a person of menak ancestry who protests against Pemda Sumedang. Menak reclaiming movement can develop until confrontation with Pemda Sumedang moreover still exist for 20 years can-t be separated from menak culture devotion to elders and keeping trusted. The resistance takes direct state organization incluing Komnas HAM, Ombudsman and letter for President, mass media, even through social media.

Keywords
Reclaiming Movement, Messianism, Menak, Land Tenure

Topic
Conflict and Reconciliation

Link: https://ifory.id/abstract/PMRHtnk97qxJ

Corresponding Author
MOCHAMAD SOCHEH

Institutions
Faculty of Animal Science, Universitas Jenderal Soedirman, Karangwangkal Kampus, Purwokerto 53123, Jawa Tengah - Indonesia
*Correnpondence E-mail: msocheh1956[at]gmail.com

Abstract
The aim of this study was to study the effect of giving different levels of energy feed on the concentrations of estrogen and progesterone during estrus and on the 14th day after mating on thin-tail ewes. The material used in this study was 15 head of thin-tail ewes aged between 2.50-3.00 years had a normal estrus cycle and had once lambing. All ewes were randomly placed into three types of treatment of energy feed with different levels, namely: non-flushing 1.01Mcal / kg ME (f0), flushing 2.13Mcal / kg ME (f1) and flushing 2,31Mcal / kg ME (f2). Each treatment was repeated 5 times. The general linear model of SPSS was used to analyze variables measured. The results showed that the average estrogen concentration in thin-tailed ewes during estrus in the flushing group (f1 and f2) was higher than non- flushing (f0). The average progesterone concentration in the thin-tailed ewes on the 14th day after mating in the flushing group (f1 and f2) was higher respectively than the non-flushing group (f0). The increase in feed energy given to thin-tailed ewes in flushing, during estrus increases estrogen concentration and on the 14th day after mating, increase progesterone concentration.

Keywords
Keywords: thin-tailed ewes, feed energy, estrus, 14 days after mating,

Topic
General animal production and husbandries (ruminants and non-ruminants)

Link: https://ifory.id/abstract/WbKYPt8N2nVp

Corresponding Author
Ning Iriyanti

Institutions
animal science fakulty, UNSOED

Abstract
IMPACT OF LIQUID FERMEHERBAFIT AS FEED ADDITIVE TO THE BLOOD HEMATOLOGICAL PROFILE AND LYMPHOID ORGAN OF BROILER CHICKENS Ning Iriyanti, Sufiriyanto and Bambang Hartoyo Faculty of Animal Science, Jenderal Soedirman University Email. ningiriyanti@gmail.com Abstract The purpose of research was to evaluates the administration time of liquid fermeherbafit used in drinking water on blood hematological profiles and lymphoid organ of broiler chickens. 1000 heads of broiler chicks 1-14 days old with prelium treatment, and 14 - 34 day-old as research treatment. Fed by BR 1 and BR2 feed of CP production. Fermeherbafit material consists of: 100% Curcuma domestica (turmeric), 100% Curcuma Xanthorrhiza R (Temulawak), 25% Allium sativum L (garlic), 50% Morinda citrifolia (Noni), 10% Moringa oleifera (Moringa leaf),10% sugar, 8% (w/v) Probiotic BAL (Lactic acid bacteria). used complete random design (RAL), with 4 treatments with 50 chickens each of 5 replicates, the liquid Fermeherbafit as much as 4% (v/w) of the feed given to the four groups: R0 = as control, R1 = daily, R2 = every two days; R3 = every Monday and Thursday. The results of Blood hematological profiles and the lymphoid organ of broiler chickens showed no significance differences (P > 0.05). The average of blood haematological profileis leukocytes were 8.830±2.01 until 8.70±1.87 (.. X 103/μl); Monocytes of 4.60±1.82 to 7.00±2.45%; Lymphocytes of 53.00±11.92 to 57.20±9.73%; Hb of 6.36±0.37 to 7.38±0.40 G/dL; Fabricius of 0.81±0.06 to 1.00±0.12%; Lymph of 0.12±0.03 to 0.24±0.16%; Thymus of 0.17±0.05 to 0.20±0.05. it can be concluded that liquid fermeherbafit through drinking water at exact time daily, every two days and every Mondays-Thursdays are reviewed in the results of blood haematological profiles as well as Lymphoid organ of broiler chickens. Keywords: Hematological profile, Lymphoid organ, Fermeherbafit

Keywords
Hematological profile, Lymphoid organ, Fermeherbafit

Topic
Feeds, feeding, and animal nutrition

Link: https://ifory.id/abstract/yQEJzMg9HBUe

Corresponding Author
Ismoyowati Ismoyowati

Institutions
Faculty of Animal Science, Universitas Jenderal Soedirman, Purwokerto, Indonesia

Abstract
The aim of this study was to determine differences in growth, carcass production and identify polymorphisms of adipocyte fatty acid binding protein (A-FABP) gene in Muscovy ducks from the second generation selection (G2). The research material used 180-day-old Muscovy ducks consisting of male and female ducks with white feathers and male and female ducks with a combination of black and white feathers. Measurement of duck body weight was carried out every week, and ducks are slaughtered at 10 weeks to obtain carcass production data. The data obtained were analyzed by systat-13 program based on variance analysis and Duncan test. The primary design was based on a database of the genebank Cairina moschata adipocyte fatty acid binding protein (A-FABP) gene, exons 1, 2 and partial cds (FJ763338.1). The primary base sequence of the A-FABP gene was the primary forward: 5- TCTGGGGGTGTTATCTGGAG -3 and reverse primer: 5- ATTTGTCAGTGGCTGTGCTG -3. The sequencing results of PCR products were analyzed using bioedit version 7.7 to determine the presence of the A-FABP gene polymorphism. The results showed that at the same age male Muscovy ducks produced carcass weight, and thickness of breast meat higher than female ducks. Body weight, carcass weight and parts of the carcass (breast, thigh, back, and wings) of a combination black-white feather male ducks higher than the male white feathers. The abdominal fat on all the ducks relatively the same. The A-FABP gene PCR product was at 176 bp. The results of bioedit analysis showed that at 151 bp, base length there was a mutation from Guanin to Adenin in the observed Cairina moschata, both male and female Muscovy ducks with white feathers and black-white combinations. All ducks observed had homozygous AA genotypes. Base changes in SNP c. 151G> A indicate a transition mutation. The study concluded that male Muscovy duck with a combination black- white feathers have highest genetic potential in body weight and carcass production with thick meat breast compared to other ducks. The weight of abdominal fat was relatively the same in male and female manila ducks. The A-FABP gene in manila ducks was monomorphic.

Keywords
Carcass percentage, Monomorphic, Muscovy duck, thick meat breast

Topic
General animal production and husbandries (ruminants and non-ruminants)

Link: https://ifory.id/abstract/cNy94qVtBY6k

Corresponding Author
Luqman Hakim

Institutions
(1) Fakultas Peternakan Universitas Bawijaya
(2) Fakultas Peternakan Universitas Jenderal Soedirman

Abstract
Abstract. Nutritional status (protein and energy) during early life has important effect on milk yield of dairy cows. Feed quantity and quality is often influenced by season representing the fluctuation of water supply which is essential for plants including forage. The aim of the present study was to analyse the effect of year and season of birth on first-lactation milk yield of Holstein Friesian cows. The data included 1005 records of first-lactation daily recorded milk yield available in National Breeding Centre for Dairy Cows and Forages of Baturraden (the so-called BBPTUHPT Baturraden) database. The milk yield was recorded within the years of 2004 to 2014. Milk yield data were adjusted to 305 standard days of milking using multiplicative-local correction factor. Animals- date of birth was grouped divided into years and months of birth. Months of birth were assigned into: (1) traditional-two season categorization (wet and dry), (2) extended-categorization of three seasons (wet, wet-dry and dry), (3) extended-categorization of four seasons (wet, wet-dry, dry and dry-wet). The effect of date of birth factor on first-lactation milk yield was tested using likelihood ratio test of full and reduced model. The result showed that both years and months of birth have significant effect on first-lactation milk yield, regardless of the season categorization. It is therefore concluded that season plays important role to consider in dairy cattle management and has to be included in genetic analysis to remove non-genetic effect which regards to first-lactation milk yield.

Keywords
birth, cows, non-genetic, Holstein, Indonesia

Topic
General animal production and husbandries (ruminants and non-ruminants)

Link: https://ifory.id/abstract/krgYU3Cf96MN