Event starts on 2019.08.06 for 3 days in Purwokerto
http://icait.conference.unsoed.ac.id | https://ifory.id/conf-abstract/jwgYMdzFX
Page 1 (data 1 to 30 of 88) | Displayed ini 30 data/page
Corresponding Author
Yusuf Subagyo
Institutions
Faculty of Animal Science, Universitas Jenderal Soedirman
*yssp2015[at]gmail.com
Abstract
The purpose of this study was to measure the adaptability and productivity of local dairy cows in Banyumas district. About 30 lactation dairy cows from two groups of dairy farmers in the Baturraden and Sumbang sub-districts of Banyumas district were used in this study. To find out the adaptability is done by measuring the rectal temperature and the frequency of respiration at 06.00 am, 10.00 am and 14.00 am. Milk productivity was measured by measuring milk every day. Measurement of all parameters was carried out for one month. The results showed that there were no significant differences (P> 0.5) between the two sub- districts for all variables, namely: rectal temperature, respiratory frequency, HTC Benezra and Rhoad, and daily milk production. It can be concluded that the adaptability of local Holstein – Frisien dairy cows in Banyumas district is good, while milk production is moderate.
Keywords
Rectal temperature; Respiratory frequency; HTC; Milk production
Topic
General animal production and husbandries (ruminants and non-ruminants)
Corresponding Author
nuzul widyas
Institutions
Department of Animal Science, Faculty of Agriculture, Sebelas Maret University, Surakarta, Indonesia
Abstract
Betaine as metabolic enhancer is proven to improve eggs production in poultry. The consistency of the improvement, however, is not yet explored. This study aimed to explore the consistency of quails- egg production under the influence of betaine supplementation utilizing intraclass correlation approach. In total 225 quails were used and allotted into three treatment groups: T0 (control), T1 (control + 0.06% betaine) and T2 (control + 0.12% betaine). Each treatment was repeated five times with 15 quails each. Egg production data was collected for 2 clutches (2 × 28 days) started after egg production reached 50%. The data was split and averaged into eight consecutive weeks. Linear model resulted in significant difference of egg production among treatments which were 66.08±18.39%, 70.55±15.11% and 75.46±14.88% for T0, T1 and T2 respectively (P<0.01). Intraclass correlation within each treatment was used as the measure of egg production consistency. Every replicate was recorded in eight consecutive weeks during the experiment. Results showed that T2 has the highest intraclass correlation (0.88), followed by T1 (0.86) and T0 (0.79). Our findings confirmed that betaine supplementation improve quails- egg production in quails. We further discover that the improvement obtained during experimental period due to betaine supplementation was more consistent compared to the quails without supplementation.
Keywords
quail, egg production, betaine, intraclass correlation, consistency
Topic
Feeds, feeding, and animal nutrition
Corresponding Author
Edy Susanto
Institutions
(a) Faculty of Animal Husbandry, The University of Islam Lamongan, Lamongan, Indonesia
* edysusanto[at]unisla.ac.id
(b) Faculty of Animal Husbandry, The University of Islam Lamongan, Lamongan, Indonesia
(c) Faculty of Animal Husbandry, University of Brawijaya, Malang, Indonesia
Abstract
This study conducted to characterization amino acids of the antioxidant bioactive peptides from Indonesian local meats among them P.O beef, Kacang goat meat, Mojosari duck meat and local chicken meat. The research was conducted in the Lamongan district of East Java. The method was laboratory exploration. The variables observed included antioxidant activity, amino acids profile with LC-MS/MS. The results of this study indicate variation in antioxidant activity of various local Meats in Indonesia. The amino acids profile also exhibit diversity with each other. Amino acids obtained are distributed evenly to the types of essential and non essential amino acids.
Keywords
Indonesian Local Meats, Antioxidant Activity, Amino Acids, LC-MS/MS
Topic
Post harvest handling and processing of meat, milk, eggs, wools, and by-products
Corresponding Author
Mohammad Miftakhus Sholikin
Institutions
1 Graduate School of Nutrition and Feed Science, Faculty of Animal Science, Bogor Agricultural University, Bogor, Indonesia
2 Department of Nutrition and Feed Technology, Faculty of Animal Science, Bogor Agricultural University, Bogor, Indonesia
Abstract
The aim of this research was to build artificial neural networks model to predict crude protein and crude fiber content from physical properties of feedstuffs. The 91 data were obtained from *https://repository.ipb.ac.id* using keywords, e.g., *sifat fisik* and *pakan*. To reduce the dimensional of the data had been transformed. The independent variables consist of specific gravity (SG), bulk density (BD), compacted bulk density (CBD) and angle of repose (AoR). The dependent variable was crude protein (CP) and crude fiber (CF). Artificial neural networks (ANN) model built by R programing language 3.6.0 using library R-base and neuralnet. The correlation and accuracy used to compare predicted and actual. ANN model of crude fiber has an accuracy of 75.08% and Pearsons signification correlation (0.7529; P <0.01). ANN model of crude fiber has an accuracy of 75.08% and Pearsons signification correlation (0.7529; P <0.01). The artificial neural networks model generally can perform better to predict crude protein and crude fiber from physical properties of feedstuffs.
Keywords
Artificial neural networks model, Crude fiber, Crude protein, Physical properties, Feedstuffs
Topic
Feeds, feeding, and animal nutrition
Corresponding Author
Alek Ibrahim
Institutions
a) Postgraduate student at Faculty of Veterinary Medicine, Universitas Gadjah Mada, Jl. Fauna No. 2, Karangmalang, Yogyakarta 55281, Indonesia
b) Faculty of Veterinary Medicine, Universitas Gadjah Mada, Jl. Fauna No.2, Karangmalang 55281, Indonesia
c) Faculty of Animal Science, Universitas Gadjah Mada, Jl. Fauna No.3, Karangmalang, Yogyakarta 55281, Indonesia
*budisatria[at]ugm.ac.id
d) Undergraduate student at Faculty of Animal Science, Universitas Gadjah Mada, Jl. Fauna No.3, Karangmalang, Yogyakarta 55281, Indonesia
Abstract
Eid al-Adha is one of the important religious festivals for Muslims in the world. Sheep traders can be divided into primary traders and opportunist traders based trade activity in this period. This study aims to investigate the preferences of sheep traders on procurement and sale of their livestock during Eid al-Adha period in Yogyakarta. This study was done by an in-depth and semi-structured interview to a total of 59 of the sheep traders. Data were analyzed using descriptive analysis (index and rank). The results are that most livestock animals purchased from the animal market, followed from farmers for primary traders and livestock traders for opportunist traders. Livestock most widely sold to individual consumers who come to their stalls, and then sold to animal market by primary traders and to organization/groups by opportunist traders. Most primary traders (64.10%) state to sell their sheep with different prices for different types of buyers, while the majority of opportunist traders (65.00%) thought no different. The average price different is IDR 286,364 according to primary traders and IDR 150,000 according to opportunist traders. Most of the primary traders (69.23%) and opportunist traders (90.00%) was pleased with the momentum of Eid al-Adha, as the selling price of their livestock could be higher, easy to sell, and any buyer. The conclusion is that both primary and opportunist traders in Yogyakarta have similar preferences in place to buy and sell their livestock during Eid al-Adha period. Eid al-Adha period provides pleasure and an additional benefit for sheep traders.
Keywords
Eid al-Adha, Livestock traders, Religious festivities, Sheep
Topic
Socio-economic aspects of animal farming
Corresponding Author
LISA PRAHARANI
Institutions
*)RESEARCH INSTITUTE FOR ANIMAL PRODUCTION
JL. Banjarwaru, Ciawi, Bogor, PO BOX 221, 16002
**)Livestock EMBRYO CENTRE
JL. Cipelang, Bogor
Abstract
The Belgian Blue (BB) is a breed of cattle characterized by double muscling. Introduction of Belgian Blue cattle to Indonesian is to increase beef production. The aim of this study was to compare birth weight and morphometric traits of purebred BB calves to F1 BB x Friesian Holstein (FH) calves. A total of 10 purebred BB calves and 20 F-1 BB x FH calves were used in this study. Results showed that birth weight and chest girth were significantly affected by genetic and sex of calves (P<0,05). The purebreds had higher birth weight and chest girth (P<0,05). The birth weight were 54,82 kg and 42,86 kg for purebreds and crossbreds, respectively. The body height were 75,30 cm and 76,35 cm for purebreds and crossbreds, respectively. The body length were 66,96 cm and 66,33 cm for purebreds and crossbreds, respectively. The chest girth were 88,46 cm and 81,15 cm for purebreds and crossbreds, respectively. This study is a preliminary information used for developing BB cattle.
Keywords
Belgian Blue cattle, crossbreeding, birth weight, morphometric traits
Topic
General animal production and husbandries (ruminants and non-ruminants)
Corresponding Author
Afduha Nurus Syamsi
Institutions
a)Departement of Diary Production, Animal Science Faculty, Universitas Jenderal Soedirman Purwokerto
*nurussyamsiafduha[at]gmail.com
b)Departement of Animal Science, Agriculture Faculty, Universitas Tidar Magelang
Abstract
The aim of this study is to examine the interaction between the meal protein source with the protein-energy synchronization index (PES) in the dairy ration on the profile of branch chain volatile fatty acids (BCVFA). The study was carried out in vitro, using factorial completely randomized design (CRD-Factorial). The first factor was 2 types of meal protein source (soybean meal and coconut meal) and the second factor was 3 levels of PES index (0.5, 0.6, and 0.7), there were 6 treatment combinations, each treatment was repeated 4 times. The results of the study showed that the interaction between the meal protein source and the PES index was not significantly affected (P> 0.05) on the levels of iso butyrate, iso valerate and valerate. The study concluded that the low PES index ration (0.5) produced a decent BCVFA profile using coconut or soybean meal.
Keywords
branched chain volatile fatty acids; meal protein source; synchronization protein-energy index
Topic
Feeds, feeding, and animal nutrition
Corresponding Author
MOCHAMAD SOCHEH
Institutions
Faculty of Animal Science, Universitas Jenderal Soedirman
Abstract
Abstract. The aim of the research is to investigate the effect of four different energy level in the ration into the calpain activity of Jawarandu does. The research was done during 5 months in the Experimental Farm of the Faculty of Animal Science, Universitas Jenderal Soedirman. The research material used was 16 heads of the Jawarandu doe with the aged 2.5−3 years. All the animals were randomly assigned to the ration treatment which forms four the different energy levels (82.26% TDN, 85, 87.93, dan 90.74% TDN). The replication of each treatment was four times. Variable measured was a calpain activity on the muscle of Longissimus dorsi. General linear model (GLM) of the SPSS was used to analysis variable measured. Energy content 1.63McalME/heads/day and 1.92McalME/heads/day as well as 1.73McalME/heads /day and 2.06McalME/heads/day were increased of the μ-calpain and m-calpain activities at the Longissimus dorsi muscle, respectively. However, there was decreased of the calpastatin activity at the Longissimus dorsi muscle. Different energy content of the ration increased the μ-calpain and m-calpain activities at the Longissimus dorsi muscle and of those decreased calpastatin activity.
Keywords
Calpain activity, Calpastatin activity, Energy level, Jawa Randu Does, Longissimus dorsi
Topic
General animal production and husbandries (ruminants and non-ruminants)
Corresponding Author
Imbang Haryoko
Institutions
Faculty of Animal Science, Universitas Jenderal Soedirman Purwokerto
Abstract
The aim of the research is to investigate the effect of four different energy level in the ration into the calpain activity of Jawarandu does. The research was done during 5 months in the Experimental Farm of the Faculty of Animal Science, Universitas Jenderal Soedirman. The research material used was 16 heads of the Jawarandu doe with the aged 2.5−3 years. All the animals were randomly assigned to the ration treatment which forms four the different energy levels (82.26% TDN, 85, 87.93, dan 90.74% TDN). The replication of each treatment was four times. Variable measured was a calpain activity on the muscle of Longissimus dorsi. General linear model (GLM) of the SPSS was used to analysis variable measured. Energy content 1.63McalME/heads/day and 1.92McalME/heads/day as well as 1.73McalME/heads /day and 2.06McalME/heads/day were increased of the μ-calpain and m-calpain activities at the Longissimus dorsi muscle, respectively. However, there was decreased of the calpastatin activity at the Longissimus dorsi muscle. Different energy content of the ration increased the μ-calpain and m-calpain activities at the Longissimus dorsi muscle and of those decreased calpastatin activity.
Keywords
Calpain activity, Calpastatin activity, Energy level, Jawarandu Does, Longissimus dorsi
Topic
General animal production and husbandries (ruminants and non-ruminants)
Corresponding Author
Ismoyowati Ismoyowati
Institutions
Faculty of Animal Science, Universitas Jenderal Soedirman, Purwokerto, Indonesia
Abstract
The aim of this study was to determine differences in growth, carcass production and identify polymorphisms of adipocyte fatty acid binding protein (A-FABP) gene in Muscovy ducks from the second generation selection (G2). The research material used 180-day-old Muscovy ducks consisting of male and female ducks with white feathers and male and female ducks with a combination of black and white feathers. Measurement of duck body weight was carried out every week, and ducks are slaughtered at 10 weeks to obtain carcass production data. The data obtained were analyzed by systat-13 program based on variance analysis and Duncan test. The primary design was based on a database of the genebank Cairina moschata adipocyte fatty acid binding protein (A-FABP) gene, exons 1, 2 and partial cds (FJ763338.1). The primary base sequence of the A-FABP gene was the primary forward: 5- TCTGGGGGTGTTATCTGGAG -3 and reverse primer: 5- ATTTGTCAGTGGCTGTGCTG -3. The sequencing results of PCR products were analyzed using bioedit version 7.7 to determine the presence of the A-FABP gene polymorphism. The results showed that at the same age male Muscovy ducks produced carcass weight, and thickness of breast meat higher than female ducks. Body weight, carcass weight and parts of the carcass (breast, thigh, back, and wings) of a combination black-white feather male ducks higher than the male white feathers. The abdominal fat on all the ducks relatively the same. The A-FABP gene PCR product was at 176 bp. The results of bioedit analysis showed that at 151 bp, base length there was a mutation from Guanin to Adenin in the observed Cairina moschata, both male and female Muscovy ducks with white feathers and black-white combinations. All ducks observed had homozygous AA genotypes. Base changes in SNP c. 151G> A indicate a transition mutation. The study concluded that male Muscovy duck with a combination black- white feathers have highest genetic potential in body weight and carcass production with thick meat breast compared to other ducks. The weight of abdominal fat was relatively the same in male and female manila ducks. The A-FABP gene in manila ducks was monomorphic.
Keywords
Carcass percentage, Monomorphic, Muscovy duck, thick meat breast
Topic
General animal production and husbandries (ruminants and non-ruminants)
Corresponding Author
MOCHAMAD SOCHEH
Institutions
Faculty of Animal Science, Universitas Jenderal Soedirman, Karangwangkal Kampus, Purwokerto 53123, Jawa Tengah - Indonesia
*Correnpondence E-mail: msocheh1956[at]gmail.com
Abstract
The aim of this study was to study the effect of giving different levels of energy feed on the concentrations of estrogen and progesterone during estrus and on the 14th day after mating on thin-tail ewes. The material used in this study was 15 head of thin-tail ewes aged between 2.50-3.00 years had a normal estrus cycle and had once lambing. All ewes were randomly placed into three types of treatment of energy feed with different levels, namely: non-flushing 1.01Mcal / kg ME (f0), flushing 2.13Mcal / kg ME (f1) and flushing 2,31Mcal / kg ME (f2). Each treatment was repeated 5 times. The general linear model of SPSS was used to analyze variables measured. The results showed that the average estrogen concentration in thin-tailed ewes during estrus in the flushing group (f1 and f2) was higher than non- flushing (f0). The average progesterone concentration in the thin-tailed ewes on the 14th day after mating in the flushing group (f1 and f2) was higher respectively than the non-flushing group (f0). The increase in feed energy given to thin-tailed ewes in flushing, during estrus increases estrogen concentration and on the 14th day after mating, increase progesterone concentration.
Keywords
Keywords: thin-tailed ewes, feed energy, estrus, 14 days after mating,
Topic
General animal production and husbandries (ruminants and non-ruminants)
Corresponding Author
Suyadi Suyadi
Institutions
1Laboraotory of Animal Reproduction and Breeding
2Laboratory of Dairy Production
Faculty of Animal Science, Universitas Brawijaya. Jl. Veteran, Malang 65145, Indonesia
Abstract
The aim of this study was to evaluate the conception rate of 11-months old dairy heifer following artificial insemination with natural estrus or treated with PGF2α at PT. Ultra Peternakan Bandung Selatan. A case study was applied in this study involving all data of 700 records for date of birth, body weight and reproduction status. Sample was selected according the complete records with criteria of age was 11±3 months, body weight >300kg, having normal reproduction organs detected by rectal palpation. The results showed that from selected 300 samples out of 700 heifers, were observed of 25 heifers were natural estrus (Control), 50 estrus after single PGF2α injection (PG), 95 following single PGF2α and left to normal estrus after 21 days (PG-N), 50 after double PGF2α (2PG), and the rest of 80 heifers showed estrus following double PGF2α – Natural estrus (2PG-N) with the conception rate (CR) of 17/25(68%), 44/50(88%), 42/50(84%), for the respective groups. None of heifers in PG-N and 2PG-N groups became pregnant after first insemination. The body weight (BW) was classified into Low (336-347kg), Medium (348-359kg) and High (360-372kg). The total conception rate was 34%. The CR for Low, Medium and High BW were 41%, 32% and 31%, respectively. The conclusion, the 11-months old heifer was possible normal pregnant following insemination without and with PGF2α injection when reached body weight over 300 kg. To ensure the higher number animal exhibiting estrus, double PGF2α injections should be applied.
Keywords
11-months old heifers, natural estrus, PGF2α induced estrus, conception rate.
Topic
General animal production and husbandries (ruminants and non-ruminants)
Corresponding Author
Tri Eko Susilorini
Institutions
Faculty of Animal Science, University of Brawijaya.
Jl. Veteran, Malang 65145, Indonesia
* Email: triekos[at]ub.ac.id
pratiwiwulan97[at]gmail.com
suyadi2008[at]yahoo.com
Abstract
This study was to evaluate the conception rate of yearling dairy heifer at PT. Ultra Peternakan Bandung Regency following artificial insemination with PGF2α-induced estrus. A total of 100 heifer records selected randomly from 700 heifers based on body weight (>300 kg) and has normal reproduction were used for this study. Non estrus animal during one day observation was then injected with PGF2α for estrus induction. The animal showing estrus within 11 days observation post PGF2α injection, was inseminated, nevertheless was reinjected for second PGF2α, and the estrus animal was inseminated according to the standard procedure. The results showed that following first PGF2α injection, 50 heifers showed estrus, while 50 non-estrus others were re-injected PGF2α. All 50 animals showed estrus following second PGF2α injection within 11 days thereafter. Body weight was divided into 3 groups, Low (<341 kg), Medium (341-355 kg), and High (>355 kg). There were significant difference (P<0.05) for Service per Conception, S/C (1.94±0.86, 1.60±0.74 and 1.78±0.87), and Conception Rate, CR (39%, 54% and 50%), respectively for Low, Medium and High body weight of yearling heifer. It was concluded that yearling dairy heifers were possible to breed and result pregnancy when reached body weight more than 300 kg.
Keywords
dairy industry, yearling heifer, estrus induction, conception rate.
Topic
General animal production and husbandries (ruminants and non-ruminants)
Corresponding Author
Wardhana Suryapratama
Institutions
a) Laboratory of Feed Science, Faculty of Animal Science,Jenderal Soedirman University, Jl. dr. Suparno 60 Purwokerto, Indonesia.
*wardhanaunsoed[at]gmail.com
b) Laboratory of Animal Feed and Nutrition, Faculty of Animal Science, Jenderal Soedirman University. Jl. dr. Suparno 60, Purwokerto, Indonesia
Abstract
A study was carried out in order to investigate the influence of Moringa oleifera leaf extract on reducing of methane production in sheep. The experiment by in vitro methode was done from June 2018 until October 2018. The treatments were ration with addition of three level of Moringa oleifera leaf extract of 0%, 0.25%, and 0.50% from dry matter (DM) of diet, respectively. Moringa oleifera leaves are dried in an oven at 60ºC for 2 x 24 hours, then ground to make extracted using ethanol. A Completely Randomized Design with six replications was applied in this experiment. The Rumen fluid was obtained from three thin-tailed sheep and was used as a source of inoculum. The diet consists of concentrate and ammoniated rice straw ratio of 60:40 based on DM and the concentrate consists of two parts of rice bran and one part of coconut meal. The results of the variance analysis and the orthogonal polynomial test indicated that the level of 0.5% Moringa oleifera leaf extract lowest of the number of protozoa and methane production, and the highest number of bacteria and microbial protein synthesis.
Keywords
Moringa oleifera, protozoa, bacteria, methane, protein synthesis of rumen microbes
Topic
Feeds, feeding, and animal nutrition
Corresponding Author
Harmini Harmini
Institutions
Balitnak
Abstract
The appearance of sheep Compass Agrinak (CA) with pastoral care management such as the habits of farmers in Indramayu district shows that CA sheep can adapt well. One of the markers can be seen from the birth weight of lambs from cross-breeding between local mother sheep and CA males. Birth weight of lambs from crosses is relatively higher than local lambs, which is 3.08: 2.5 kg for females and 3.50: 3.04 for males. Some problems that require more careful observation where CA sheep die because of "swallowed/consumed" plastic that may still have left in them as food leftovers consumed by humans wrapped in plastic bags, so that when eating the leaves "eaten" also the plastic wrap that blocks the system digestion and breathing which eventually die. Technology guidance on the preparation of sheep feed from rice (straw) by-products has been carried out at the Bogor experimental station as well as making good and true block minerals and sheep cultivation. Preparations for developing BC sheep to be "averted" at the UPTD are being prepared by the pregnancy test through USG
Keywords
Compass Agrinak Sheep
Topic
Socio-economic aspects of animal farming
Corresponding Author
Femi Hadidjah Elly
Institutions
1)Faculty of Animal Husbandry, University of Sam Ratulangi, Manado,
North Sulawesi, Indonesia
2)PEMDA, North Bolaang Mongondow, Indonesia
Abstract
ABSTRACT Local cattle farming as a source of income for farmers in rural areas, mostly developed traditionally. The local cattle farm continues, even though it is a side business, but is a mainstay in supporting national beef needs. Local cattle farmers utilize food crops as feed that is available continuously, so that the cost of feed can be reduced. On the other hand, local cattle waste can be used as organic fertilizer which functions to increase soil fertility. This condition shows that local cattle farms symbiosis in mutualism with food crops. The problem is whether local cattle farms integrated with food crops have the potential to be developed by farmers. The study was conducted aimed at analyzing the extent to which the potential for the development of integration of local cattle and food crops in rural areas. The research method used is the survey method. The research location was Sangkub District, which was determined by purposive sampling because it had farmers who developed local cattle farms integrated with food crops. The number of respondents is 60 farmers. Analysis of the data used is proximate analysis and feasibility analysis. Proximate analysis of waste corn shows Dry Material 86.48%, Crude Protein 7.36%, Fat 1.84%, Crude Fiber 28.95%, Ash Content 9.10% and Carbohydrate 68.18%. Government programs to support increased livestock farmers income through increasing local cattle population, consequently an increase in cattle waste. Food crop waste has not been utilized but burned by rural farmers who have an impact on the environment. The RC ratio analysis results show a greater value of one. Based on the results of the study it can be concluded that the integrated farming system, local cattle and corn plants are feasible and can minimize environmental pollution because the concept of LEISA (Low External Input Sustainability Agriculture) can be applied.
Keywords
integration, local cattle, food crops, LEISA
Topic
Socio-economic aspects of animal farming
Corresponding Author
Artise H S Salendu
Institutions
1) Faculty of Animal Husbandry, University of Sam Ratulangi, Manado,
North Sulawesi, Indonesia 95115
2)PEMDA, North Bolaang Mongondow, Indonesia
3)BPTP Kalasey, North Sulawesi, Indonesia
Abstract
The purpose of the development of beef cattle farming is to increase the population and productivity of cattle products followed by increasing the income of farmers, creating jobs and improving the genetic quality of beef cattle. The problem is that beef cattle farms in North Sulawesi are still carried out traditionally and have not been environmentally. Beef cattle are developed by most farmers by grazing on agricultural land. Based on these problems, a study was conducted to find out strategies that could be applied to support the development of beef cattle farms, which are environmentally. The purpose of this study was to analyze the role, opportunities and challenges of beef cattle farms in North Bolaang Mongondow Regency. This research was conducted in the North Bolaang Mongondow Regency using the survey method. The research location was determined by purposive sampling, namely Sangkub, Bintauna and East Bolangitan Districts which carried out the development of beef cattle. Analysis of the data used is the SWOT analysis. The results showed that the prospect of developing beef cattle farms was analyzed based on land potential which showed that the real population could be increased to 1.37 times. The development of beef cattle farming is carried out with an environmental and sustainable orientation, through development with the concept of LEISA (Low External Input Sustainability Agriculture). Conclusion, the development of beef cattle has a role in increasing the income of farmers and has market opportunities, and the challenges can be minimized by increasing the productivity and quality of beef cattle that are environmentally oriented. technology introduction is needed for the development of sustainable beef cattle farms.
Keywords
Beef cattle, development, strategy, environment
Topic
Socio-economic aspects of animal farming
Corresponding Author
Titin Widiyastuti
Institutions
faculty of Animal Science, Jenderal Soedirman University
Abstract
Rice has many kind of varieties with varied organic ingredients. The purpose of this study is to assess influence of varied organic matter content on digestibility and fermentation products in rumen. The method of research is done by in vitro, using completely randomized design with 6 varieties of rice bran as treatments (Pandan Wangi, Ketan Putih, IR 64, Aek Sibundong, Ketan Hitam and Umbul). Each treatment is repeated 3 times, continued by Honestly Significant Difference (HSD). The objective of the research was to evaluate VFA level, N-NH3, dry matter digestibility (DMD) and organic matter digestibility (OMD). Results of analysis of variance showed that the rice bran varieties have a Highly significant effect on the levels of VFA (P < 0.01), but its not significant effects on N-NH3 level, DMD and OMD. A highly significant difference is shown by rice bran of Pandan Wangi varieties with Ketan Putih and Ketan Hitam. Based on the results can be concluded that rice varieties affect the level of VFA but do not affect the level N-H3, DMD and OMD, Pandan Wangi varieties has the highest VFA produce in the rumen.
Keywords
Rice varieties, VFA, N-NH3, DMD, OMD, in vitro
Topic
Feeds, feeding, and animal nutrition
Corresponding Author
Ismoyowati Ismoyowati
Institutions
Universitas Jenderal Soedirman
Abstract
Poultry meat and eggs are one of the most widely consumed livestock food in various parts of the world, across a wide variety of cultures, traditions and religions. In 2016 the duck population (Anas spp.) throughout the world reached 1.24 billion and 1.1 billion (89 percent) were in Asia. The production of meat and duck eggs is still under chickens, but ducks make a significant contribution in providing high-quality nutritional food needs. The consumption of duck eggs accounts for around 10-30% of total egg consumption in China and Southeast Asia. Duck eggs contain all essential amino acids required by the human diet and are a good source of vitamins and minerals. Due to lower water content, they are more nutrient than chicken eggs. Asian is the leading continent in duck meat production with a share of 82.2%, followed by Europe with 12.4%. Asia has also the highest increase of total and of per capita duck meat by 308% and 244%, respectively. Almost 10 percent of poultry meat in Asia is compared to 4.1% in the world. People consume the duck meat because of their high nutritional value with complete essential amino acid composition and good fatty acid composition with a high percentage of polyunsaturated fatty acids and a balanced ratio between omega-6 fatty acids and omega-3. Large-scale duck production requires more efforts for higher efficiency and improving product quality by breeding, nutrition and management in accordance with animal welfare requirements and environmental protection. Family duck farmers (small-scale production) with limited capital contribute significantly to food security, poverty alleviation and the ecologically sound management of natural resources. Farmers must have more access to obtain good duck breed, appropriate technology and service support, which can substantially increase productivity, income and food security.
Keywords
Duck, meat, egg, food security
Topic
General animal production and husbandries (ruminants and non-ruminants)
Corresponding Author
Maureen Chrisye Hadiatry
Institutions
a) Banten Assessment Institute for Agricultural Technology (AIAT). Jl. Ciptayasa Km.01 Ciruas, Serang, Banten 42182
*mchris0501[at]yahoo.co.id
b) Indonesian Research Institute for Animal Production (IRIAP) Jl. Veteran 3, Ciawi, Bogor
c) Animal Production Systems Group, Wageningen University. PO BOX 338 6700 AH Wageningen The Netherlands
Abstract
A study on duck production systems was conducted in Banten Province, Indonesia. The objective of the study was to assess the economic contribution of duck production systems for smallholders livelihood. Four duck production systems were distinguished in the research area; a fully yarded-small scale system (DPS 1), a fully yarded-large scale system (DPS 2), a combination of yarded and scavenging system ( DPS 3) and a combination of herded, scavenging and yarded system (DPS 4). Primary data was gathered from 43 respondents using a questionnaire. The economic parameter such as costs, benefits, gross margin and income contribution from each duck production system were calculated. Data were analyzed using the Kruskall-Wallis test. From the result, the highest family labor time was in DPS 4 (7.0±0.48 hours/hh/day) and the lowest was in DPS 2 (2.0±1.00 hours/hh/day). Compared to other systems, DPS 2 had the highest labor cost (14,400¬± 4,800 (thousand IDR/year)) and gross margin (131,875.65±28,152.85 (thousand IDR/year)). In Banten Province, duck production systems contributed to smallholders- livelihoods. In some cases, it only gave a small contribution (DPS 3) or even negative contribution (DPS 1) to the households income. In other cases, it resulted in good output (DPS 2 and DPS 4).
Keywords
duck production systems; economic contribution
Topic
Socio-economic aspects of animal farming
Corresponding Author
modawy abdelgader
Institutions
Faculty Of Animal Husbandry, University of Jenderal Soedirman
Abstract
Molasses can be a source of quick energy and an excellent source of minerals for farm animals and even chickens. Molasses can also be a key ingredient for cost effective management of feeds. The purpose of this research was to study the impact of adding different levels of sugar beet molasses to feed on performance of broilers chickens. Used 112 of commercial broiler (Ross 308) l-day-old chicks were weighed in gram live weight ranged between 50-57g and subsequently placed in the treatment groups in such a way that the mean weights differed as little as possible, chicks divided into four groups replicates of 7 chicks each and reared on deep litter in open housing system. Four replicates were designed to each dietary treatment. at 15-days-old chicks, the unsexed broiler chickens were randomly allotted to four groups of 7 birds each. The four diets consisted of Group (A) as a control diet containing no Molasses, Group (B) was 5 %, Group (C) 7.5 % and Group (D)10%. Feed and water were provided adlibtum. There were no significant differences at all level (P<0.05) of adding beet molasses as source of energy among four experimental groups for the parameter studied: body weight, body weight gain, feed intake and feed conversion, also there is no mortality however, Use of beet molasses in broiler diets reduced feed cost and feeding of 7.5 % beet molasses decreased cost of feed per kg versus control and increase profitability. Keywords: beet molasses, broiler chickens, performance
Keywords
beet molasses, broiler chickens, performance
Topic
Feeds, feeding, and animal nutrition
Corresponding Author
Elly Tugiyanti
Institutions
Faculty of Animal Science, University of Jenderal Soedirman, Purwokerto 53123
Abstract
The aim of this research was to understand the effect of liquid probiotic supplementation in drink water on blood cholesterol ( HDL, LDL,Triglyceride) level, hemaglobin level (Hb), plasma hematocrit level and total of plasma protein (TPP) of quails. Prohibition of antibiotics in poultry, resulting in increased probiotic offers on the market. Each probiotic has an advantage in increasing productivity and immunity of quails. The research was conducted as an experimental research and used completely randomized design. Four treatments were done in this research, which was control (drink water without probiotic), drink water added by probiotics A (containing Lactobacillus sp., Rhodopseudomonas sp., Streptococcus sp., Saccarhomyches sp.), probiotic B (containing Bacillus careus, Azotobacter paspalii, Bacillus laterosporu, Bacillus lentus, Bacillus licheniformes, Bacillus pumilus Corynebacterium, Pseudomonas fluorescens Sarcina lutea Staphylococcus epidermis Staphylococcus thermophyllus Lactobacillus sp. Saccharomyces cerevisceae and Phicia anomola) and probiotic C (containing Lactobacillus casei, Saccharomyces cerevisceae, Rhodopseudomonas palustris, Molases, water). The obtained all data were then analyzed by analysis of variance and if the result showed a significant effect, further analysis will be done by honestly significant difference test. The analysis of variance showed that variety of fluid probiotic supplementation in drink water showed had no significant effect (P>0.05) on the on blood cholesterol, HDL level, LDL level, triglyceride, but had significant effect (P<0.05) on Hb, plasma hematocrit and TPP level. The research concluded that liquid probiotics supplementation in drink water will increase immune response but not able to reduce blood cholesterol of quails.
Keywords
Antibiotics, Probiotics, Drink water, Cholesterol, Quails.
Topic
General animal production and husbandries (ruminants and non-ruminants)
Corresponding Author
Retno Iswarin Pujaningsih
Institutions
Faculty of Animal Agriculture, Diponegoro University of Semarang
Abstract
The research was managed to assess organic basic multi-nutrient block supplementation on the performance of Kacang goat that fed by total mixed ratio in feedlot system. This research was carried out for 3 months, used 15 goats with the average body weight of 13.40 ± 1.97 kg. The study was arranged in a completely randomized design with 3 treatments and 5 replications. Goats were divided and fed with one of the treatments as follows: P0: only forage, according to the farmer-s way; P1: total mixed ratio; P2: total mixed ratio + 15g multinutrient block/head/day. Variables of initial body weight, final body weight, body weight gain, and feed consumption were observed. The study indicated that goats of P1 and P2 had a significantly higher final body weight in average of 29,32 and 32,38 kg (P < 0.05) compared with P0 (27,45 kg), respectively. Body weight gain of goat P2 was significantly higher (P < 0.05) than P1 Kacang goat. This study suggests that treatment P2 resulted in the highest body weight gain.
Keywords
multinutrient block, organic supplement, TMR, Kacang Goat
Topic
Feeds, feeding, and animal nutrition
Corresponding Author
Wisje Lusia TOAR
Institutions
a) Animal Science Program, Faculty of Animal Husbandry, Sam Ratulangi University. Jalan Kampus Unsrat, Manado 95115. Indonesia
*wisje_toar[at]live.com
b) Entomology Program, Postgraduate School, Sam Ratulangi University. Jalan Kampus Unsrat, Manado 95115. Indonesia
Abstract
The purpose of this study was to determine the role of the combination of curcuma meal with maggot or BSF (Blue Soldier Flies) insect larvae of Hermetia illucens on accumulative weight gain in native chicken. Methods: This study used 60 starter chickens aged 3 weeks, which were divided into two groups of 30 chickens as control group (P1) and the other one (P2) that received a supplement of combination of curcuma meals of 350gr / 100 kg ration and maggot BSF of 150gr / 100 kg ration which was maintained for five weeks. The ration was distributed ad libitum. Accumulative weight gain was measured at the end of the study at the sixth week. The data obtained were analyzed using t-test The results of this study indicated that the average body weight of experimental chicken P2 was 0.450 gr significantly higher (P <0.01) than in group P1 was 0.390 gr. The maggot meal of H. illucens has an important nutrient content and has a positive effect when combining with curcuma meal which is able to increase consumption palatability which has a direct effect on local chicken weight gain. Conclusion: The combination between BSF maggot and curcuma meals supplementation could be applied to local chickens in supporting organic livestock production
Keywords
: Insect, BSF, native chickens
Topic
Feeds, feeding, and animal nutrition
Corresponding Author
Luqman Hakim
Institutions
(1) Fakultas Peternakan Universitas Bawijaya
(2) Fakultas Peternakan Universitas Jenderal Soedirman
Abstract
Abstract. Nutritional status (protein and energy) during early life has important effect on milk yield of dairy cows. Feed quantity and quality is often influenced by season representing the fluctuation of water supply which is essential for plants including forage. The aim of the present study was to analyse the effect of year and season of birth on first-lactation milk yield of Holstein Friesian cows. The data included 1005 records of first-lactation daily recorded milk yield available in National Breeding Centre for Dairy Cows and Forages of Baturraden (the so-called BBPTUHPT Baturraden) database. The milk yield was recorded within the years of 2004 to 2014. Milk yield data were adjusted to 305 standard days of milking using multiplicative-local correction factor. Animals- date of birth was grouped divided into years and months of birth. Months of birth were assigned into: (1) traditional-two season categorization (wet and dry), (2) extended-categorization of three seasons (wet, wet-dry and dry), (3) extended-categorization of four seasons (wet, wet-dry, dry and dry-wet). The effect of date of birth factor on first-lactation milk yield was tested using likelihood ratio test of full and reduced model. The result showed that both years and months of birth have significant effect on first-lactation milk yield, regardless of the season categorization. It is therefore concluded that season plays important role to consider in dairy cattle management and has to be included in genetic analysis to remove non-genetic effect which regards to first-lactation milk yield.
Keywords
birth, cows, non-genetic, Holstein, Indonesia
Topic
General animal production and husbandries (ruminants and non-ruminants)
Corresponding Author
Mohamad Maulana
Institutions
Indonesian Centre for Agricultural Socio Economic and Policy Studies (ICASEPS)
Abstract
Research on the efficiency of egg-s supply chain focused on various markets is expected to provide input to maintain the existence of small scale layers- farming. This study aim is to analyze the supply chain efficiency of small-scale layers- farming. This research is conducted in April-October 2017 in Blitar Regency, in East Java; Sidrap Regency, in South Sulawesi; and Kabupaten 50 Kota, in Payakumbuh City and Pariaman Regency, in West Sumatra. The number of respondents used are 139 people consisting of officers in related institutions, poultry shop entrepreneurs, traders, breeders association farmers, supermarket managers, hotels, restaurants and caterings. The data collected is analyzed using the Data Envelopment Analysis (DEA). The results concludes that traders naturally seek efficient supply chains so that their business can be endured. Factors that influence supply chain efficiency are share farmer, profit and marketing cost ratio, and number of actors involved. The higher the farmer share, and the profit-to-cost ratio, and the fewer marketing channel in a supply chain, the more efficient the supply chain system. Large capital farmers are advised to be able to shorten the supply chain by marketing directly to consumers such as hotels, supermarkets, restaurants, hospitals and caterings. The egg supply chain can also utilize the Indonesian Farmer Shop (TTI) developed by the Ministry of Agriculture so that it can increase farmer-s income and stabilize prices.
Keywords
supply chain, efficiency, egg, DEA
Topic
Socio-economic aspects of animal farming
Corresponding Author
Jein Rinny leke
Institutions
1Animal Husbandry Faculty, Sam Ratulangi University
2Biology Department, Faculty of Mathematics and Natural Sciences, Sam Ratulangi University
Abstract
The research purpose was to determine the egg quality characteristic of laying hens fed hens dried garlic (allium sativum) in diet. The research method was used completely random design with five treatments and five replicates. The materials used for this research were 100 laying hens.The treatments used for research were dietary with R0 = 100 % based diet (BD); R1= 98% based diet (BD) + 2% garlic meal (GM); R2= 96 % based diet (BD) + 4 % GM, R3 = 94% based diet (BD) + 6% GM, R4 = 92% based diet (BD) + 8% GM. The study was conducted over a period of eight (8) weeks. Data were collected on eggs quality, egg weight, egg shell weight, egg shell thi egg shell weight, but egg weight , albumen weight and egg shell thickness significant. The data analysis of variance (ANOVA) and continued by Duncan-s multiple range test. The results showed that using the yolk weight, egg shell weight has significant different ( P 0.05) on egg weight, albumen weight and egg shell thickness significantly different ( P 0.01). It can be concluded that garlic meal can be used as an alternative feedstuff in laying hen diets at inclusion level up to 8% without negative effects on egg quality characteristis.
Keywords
Dried garlic, Egg quality, Laying hens
Topic
Feeds, feeding, and animal nutrition
Corresponding Author
Agus Susanto
Institutions
1) Graduate Program, Faculty of Animal Science, Brawijaya University (UB), Malang, Indonesia
2) Faculty of Animal Science, Brawijaya University (UB), Malang, Indonesia
3) Faculty of Animal Science, University of Jenderal Soedirman (UNSOED), Purwokerto, Indonesia
Abstract
Nutritional status (protein and energy) during early life has important effect on milk yield of dairy cows. Feed quantity and quality is often influenced by season representing the fluctuation of water supply which is essential for plants including forage. The aim of the present study was to analyse the effect of year and season of birth on first-lactation milk yield of Holstein Friesian cows. The data included 1005 records of first-lactation daily recorded milk yield available in National Breeding Centre for Dairy Cows and Forages of Baturraden (the so-called BBPTUHPT Baturraden) database. The milk yield was recorded within the years of 2004 to 2014. Milk yield data were adjusted to 305 standard days of milking using multiplicative-local correction factor. Animals- date of birth was grouped divided into years and months of birth. Months of birth were assigned into: (1) traditional-two season categorization (wet and dry), (2) extended-categorization of three seasons (wet, wet-dry and dry), (3) extended-categorization of four seasons (wet, wet-dry, dry and dry-wet). The effect of date of birth factor on first-lactation milk yield was tested using likelihood ratio test of full and reduced model. The result showed that both years and months of birth have significant effect on first-lactation milk yield, regardless of the season categorization. It is therefore concluded that season plays important role to consider in dairy cattle management and has to be included in genetic analysis to remove non-genetic effect which regards to first-lactation milk yield.
Keywords
birth, cows, non-genetic, Holstein, Indonesia
Topic
General animal production and husbandries (ruminants and non-ruminants)
Corresponding Author
Zuratih Zuratih
Institutions
1) Indonesian Centre for Animal Research and Development
Jalan Pajajaran Kav E59, Bogor 16128, Indonesia
*zuratih89[at]gmail.com
2) Indonesian Research Institute for Animal Production
Jalan Veteran III Ciawi, Bogor 16720
Abstract
Livestock sector contributes to the increase of global warming through gas released from enteric fermentation and manure management. National estimation still used manual calculation. The aim of this study was to estimate the contribution of greenhouse gas (GHG) emissions from livestock sector by using ALU tool version 6.0.1, in West Java Province for year 2016 as the case study. The emissions were calculated by using Tier-1 and Tier-2 methodologies. Data used were livestock population and emission factors (EF) of CH4 and N2O of any livestock. The results showed that emission from enteric fermentation was 94.754 Gg CH4/year or 2,368.850 Gg CO2e/year with the highest emission from sheep (50.194 Gg CH4/year or 1,254.850 Gg CO2/year). While emission of CH4 from manure was 6,767 Gg CH4/year or 169,175 Gg CO2e/year with the highest emission from dairy cattle (2,870 Gg CH4/year or 71,750 Gg CO2e/year) and direct N2O emissions from manure was 0.366 Gg N2O/year or 109.138 Gg CO2e/year with the highest emission from sheep (0.189 Gg N2O/year or 56.212 Gg CO2e/year). As a conclusion, total emissions from the livestock sector in West Java Province are 2,647.163 Gg CO2e/year with the largest emissions from enteric fermentation (2,368.850 Gg CO2e/year). In conclusion that ALU tool is applicable to estimate GHG emission for Livestock in Indonesia, with has limited data available.
Keywords
Greenhouse Gas emission, Livestock, West Java Province, ALU Tools
Topic
Feeds, feeding, and animal nutrition
Corresponding Author
widodo suwito
Institutions
1) Assessment Institutes for Agricultural Technology of Yogyakarta
JL. Stadion Baru Maguwoharjo No. 22, Karang Sari, Wedomartani, Ngemplak, Sleman, Yogyakarta (0274) 884662.
* Corresponding author email: widodo.suwito[at]yahoo.com
2) Faculty of Veterinary Medicine, Gadjah Mada University, JL. Fauna No. 2, Bulaksumur Yogyakarta 55281
3) Research Institute Veterinary Science
Jl. R.E. Martadinata No.30 Kotak Pos 151, Bogor, Indonesia, 16124
Abstract
Subclinical mastitis in Ettawa crossbreeds (PE) is an inflammatory disease that no clinical symptoms, but there is an increase the number of somatic cells and causes decrease milk production which economically detrimental. The aim of this study was to isolation of bacteria that causing subclinical mastitis in PE goats and their sensitivity with antimicrobial. A total of 37 PE goats from 5 farms in Kulonprogo were tested by California Mastitis Test (CMT). PE goats were said subclinical mastitis if the CMT test positive (++) or (++). Bacterial examination was carried out by enrichment in the peptone water buffer medium (BPW), and cultured in mannitol salt agar (MSA), eosin methylene blue agar (EMBA), and blood agar plate (PAD). Bacterial identification based on Gram staining, and biochemical tests such as confectionery. Subclinical mastitis in PE goats in Kulonprogo was caused by S. intermedius positive coagulase 4/4 (100%), S. aureus negative coagulase 4/10 (40%), S. aureus positive coagulase 3/10 (30%), and E. coli 1/10 (10%). S. intermedius positive coagulase was resistant to ampicillin, tetracycline, and sulfamethoxazole 2/4 (50%) respectively. S. aureus positive coagulase was resistant to ampicillin 2/7 (28.6%), penicillin 1/7 (14.3%), and sulfamethoxazole 1/7 (14.3%). S. aureus negative coagulase was resistant to ampicillin 3/7 (42.9%), penicillin 3/7 (42.9%), sulfametoxazole 2/7 (28.6%), and tetracycline group 1/7 (14.3%). This study showed that subclinical mastitis PE goats in Kulonprogo were caused by S. intermedius positive coagulase and S. aureus negative coagulase which are resistant to penicillin and sulfamethoxazole.
Keywords
Isolation, subclinical mastitis, PE goat, antimicrobial
Topic
General animal production and husbandries (ruminants and non-ruminants)
Page 1 (data 1 to 30 of 88) | Displayed ini 30 data/page
Featured Events
Embed Logo
If your conference is listed in our system, please put our logo somewhere in your website. Simply copy-paste the HTML code below to your website (ask your web admin):
<a target="_blank" href="https://ifory.id"><img src="https://ifory.id/ifory.png" title="Ifory - Indonesia Conference Directory" width="150" height="" border="0"></a>Site Stats